Humaira Imam ( Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, Multan, Pakistan. )
Tahira Imam ( Quaid e Azam Medical College, Bahawalpur, Pakistan. )
Syeda Zahra Abbas ( Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, Multan, Pakistan. )
Mehreen Ismail ( Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, Multan, Pakistan. )
Syed Aun Muhammad ( Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, Multan, Pakistan )
August 2021, Volume 71, Issue 8
Research Article
Abstract
Objective: To investigate the single nucleotide polymorphic variations of N-acetyltransferase 2, phase-II metabolising enzyme, and associated risk factors for oral cancer.
Method: The case-control study was conducted from November 2017 to April 2018 after approval from the Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, Multan, Pakistan, and comprised oral cancer patients and healthy controls. Single nucleotide polymorphism of the N-acetyltransferase 2 gene associated with oral cancer was analysed. Factors assessed using tetra-primer amplification refractory mutation system polymerase chain reaction included age, smoking, naswar, betel leaves and nuts.
Results: Of the 201 subjects, 94(47%) were patients and 107(53%) were controls, while 108(54%) were aged 10-30 years. Single nucleotide polymorphism rs1208 of N-acetyltransferase 2 gene was primarily A803G and Lys268Arg, with allelic frequency of G/A. Age range 51-70 was significantly (p=0.00001) associated with the prevalence of oral cancer in terms of genotypic relationship with A803G. Substantial allelic association was found between the gene and oral cancer (p=0.006895). Smoking increased the cacner risk 7-fold (odds ratio: 7.0).
Conclusion: The genetic variant of N-acetyltransferase 2 rs1208 was found to be significantly associated with oral cancer progression and development of associated risk factors.
Keywords: Oral cancer, N-acetyltransferase 2, SNP, Tetra arms PCR. (JPMA 71: 1954; 2021)
DOI: https://doi.org/10.47391/JPMA.1229
Introduction
Oral cancer (OC), or mouth cancer, is a subtype of head and neck cancer developing a tumour in the oral cavity.1 Approximately at around 3% of all malignancies, OC occurrence worldwide is around 500,000 cases annually,2 making it the second leading cause of death in both men and women.3 In India and Pakistan, 8-10% (1/3rd) of all cancers occur in the oral cavity.4-6 OC is more frequent after age 40, peaking at 60 years. It is more lethal in males than females with a ratio of 2:1.7-9 There is a need to develop therapeutic strategies to cope with this situation.
The N-acetyltransferase 2 (NAT2) metabolising gene is present on chromosome 8p21 region10 that contains two exons with one long intron of about 8.6 kb. Exon 1 is very short (100 bp), and the entire protein coding region is contained within the 870-bp exon 2. NAT2 alleles having high and low activities are associated with a variety of malignancies.11,12 The NAT2 gene is a well-known phase-11 xenobiotic metabolising enzyme (XME) and polymorphism of XME genes is strongly associated with OC risk.13 OC is a multi-factorial disease having interaction with various genetic and environmental factors.14 The single nucleotide polymorphism (SNP) rs1208 of NAT2 gene mutates A803G and Lys268Arg with the allele origin of G/A, with A being the ancestral allele.10 This SNP was observed in rapid acetylators, and the risk allele for it is G.15 A830G is not associated with a reduction in O-and N- acetyltransferase catalytic activity and also not in protein expression and stability.
NAT2 is a highly polymorphic enzyme affecting the activity of the enzyme and differentiating the individuals as rapid, intermediate and slow acetylators.12,16-19 The frequency of OC is getting higher due to population growth, aging and irrational lifestyle.20 In Asian countries, tobacco is extensively used, and about 90% OC cases are caused by tobacco and its products.5,21 Diet lacking in fruits and vegetables, antioxidants, vitamins, minerals, and comprising processed meat is carcinogenic, leading to OC.22,23
The current study was planned to find the genetic polymorphisms of OC associated with phenotypic and genotypic variations in a specific region.
Patients and Methods
The case-control study was conducted from November 2017 to April 2018 after approval from the Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University (BZU), Multan, Pakistan, and comprised oral cancer patients and healthy controls. The sample size and statistical analysis was calculated using a MedCalc for Windows, version 19.6.4 (MedCalc Software, Ostend, Belgium).24 SNP was analysed with an odds ratio (OR) 2 at 95% confidence interval (CI), 5% minor allele frequency with case-control ration 0.909 ratio, and error rate in an allelic test 6.9%. The sample size for a common SNP was significant (p<0.05). The sample was raised using opportunity sampling technique.
The subjects were categorised into control Group 1 having unaffected, normal and healthy individuals without any clinical signs and symptoms of OC, and patient Group 2 having clinically-diagnosed OC patients.
After taking consent, data was collected related to age, smoking, and consumption of naswar, betel leaves and nuts using the standard interviewer-administered questionnaire.
SNP primers were designed using Soton Primer software. Tetra-primer amplification refractory mutation system (ARMS) polymerase chain reaction (PCR) amplification procedure was included: forward inner (G-allele) CTGAGGAAGAGGTTGAAGAAGTGCTTAG, forward outer TGCCAAAGAAGAAACACCAAAAAATATA, reverse inner (A-allele) TTCTCCCCAAGGAAATCTTAAATATATGTT and reverse outer TTCTTCAAAATAACGTGAGGGTAGAGAG with 600C for annealing temperature. Deoxyribonucleic acid (DNA) was extracted from blood samples as per standard protocols. The extracted genome was quantified by UV spectrophotometer (Perkin Elmer Lambda 25). Tetra-ARMS PCR refractory mutational-based thermo-cycler (PCR Biometra T-Gradient) was used to study the genetic and polymorphic variations.25 Only a single nucleotide variant of NAT2 (rs1208) was investigated for polymorphic association. In this process, four SNP-specific primers, including 0.5 µl inner-forward, 0.5µl inner-reverse, 1µl outer-forward, and 1µl outer-reverse, were used to amplify the NAT2 genetic variant rs1208 and to observe its allelic frequencies.
Genotypic frequencies of NAT2 rs1208 with OC were calculated. The allelic frequency of the genetic variant of NAT2 rs1208 was calculated using Hardy-Weinberg equilibrium for the wild type allele, and mutant type allele in both the cases and the controls. Statistically, values were analysed using the chi-square goodness of fit test with a degree of freedom to study the associated risk factors with genetic variants and OC. OR, standard error (SE) and 95%CI were measured using the online MedCalc statistical calculator with a significant cut-off value p=0.05.25.26 Hardy Weinberg equilibrium (HWE) was used to calculate the frequency of NAT2 variations either for mutant or wild type alleles.
Results
Of the 201 subjects, 94(47%) were patients and 107(53%) were controls, while 108(54%) were aged 10-30 years. Male gender, smoking, age and family history were significantly associated with OC-progression (Table 1).

NAT2 SNP displayed three bands and indicated heterozygous A/G allele (Figure).

Smoking increased OC risk 7-fold, while betel leaf and naswar usage were not found to be significant (Table 2).

Discussion
Oral cancer is a multi-factorial disease having interaction with various genetic and environmental factors.14 The current study analysed SNP of NAT2 associated with OC in southern Punjab, and found the association of genetic polymorphisms of NAT2 with various demographic risk factors. The findings of the current study are in line with literature.2,7,19,27
We have observed the distribution of NAT2 alleles in population of the Southern Punjab and accounted for most NATs in other nations.28 In control and cancer patients, risk factors including gender, age, smokers, chewers, and others have not been similar. It has been reported that gender is an important factor and males have been found to be more vulnerable than females to disease development (p=0.037009).2,7 This study shows the association of phenotypes with the high risk of oral cancer. The interaction between the NAT1 and NAT2 polymorphisms with these phenotypes is probably due to the role of NATs in nitrosamine metabolism as the most significant carcinogen in the use of tobacco and other components of the molecules.29 The frequencies of genotypes and phenotypes are different in our population, however the distribution of normal, rapid and slow acetylators in the control population was found similar in African population, but it was different from Japanese and Turkish populations.30,31 NAT2 alleles having high and low activities are associated with a variety of malignancies. This gene has SNPs affecting the activity of the enzyme and thus differentiating the individuals as rapid, intermediate, and slow acetylators.11,12 It has been shown that the homozygous ancestral allele is more prevalent in cases as compared to the control-subjects.7 We observed significant outcomes about the homozygous distorted G allele. It is dominant in both controls and cases. A recent study among a Chinese population found a CC genotype of NAT2 rs1565684 T>C polymorphism indicating significantly higher risk of oral cancer.32 We found statistically meaningful association of oral cancer with NAT2 polymorphism.
Conclusions
Genetic variant of NAT2 rs1208 was found to be significantly associated with OC. Genetic and environmental risk factors, like smoking tobacco, gender, aging and family history were major risk factors.
Disclaimer: None.
Conflict of interest: The person who signed the ethical review statement is also a co-author.
Source of Funding: None.
References
1. Kujan O, Farah CS, Johnson NW. Oral and oropharyngeal cancer in the middle east and north africa. Translational Res Oral Oncol 2017; 2: 1-9.
2. Nagi R, Reddy-Kantharaj YB, Rakesh N, Janardhan-Reddy S,Sahu S. Efficacy of light based detection systems for early detection of oral cancer and oral potentially malignant disorders: Systematic review. Med Oral Patol Oral Cir Bucal 2016; 21: e447-55.
3. Siegel RL, Miller KD, Jemal A. Cancer statistics. CA Cancer J Clin 2018; 68: 7-30.
4. Imam SZ, Nawaz H, Sepah YJ, Pabaney AH, Ilyas M,Ghaffar S. Use of smokeless tobacco among groups of pakistani medical students–a cross sectional study. BMC Public Health 2007; 7: 231.
5. Rao SVK, Mejia G, Roberts-Thomson K, Logan R. Epidemiology of oral cancer in asia in the past decade-an update (2000-2012). Asian Pac JCancer Prev 2013; 14: 5567-77.
6. Al Bulushi NM, Macpherson LM, Worlledge-Andrew H, Gibson J, Ross AJ, Conway DI. A protocol for a systematic review of clinical guidelines and published systematic reviews on the early detection of oral cancer. Translational Res Oral Oncol 2016; 1: 1-6.
7. Neville BW, Day TA. Oral cancer and precancerous lesions. CA Cancer J Clin 2002; 52: 195-215.
8. Organization WH. Global data on incidence of oral cancer. Geneva, Switzerland: World Health Organization; 2005.
9. Gill MK. Light-based headways: An innovation in oral cancer espial. Oncobiology and Targets 2017; 4: 1-4.
10. Feki-Tounsi M, Khlifi R, Louati I, Fourati M, Mhiri MN, Hamza-Chaffai A. Polymorphisms in XRCC1, ERCC2, and ERCC3 DNA repair genes, CYP1A1 xenobiotic metabolism gene, and tobacco are associated with bladder cancer susceptibility in Tunisian population. Environ Sci Pollut Res 2017; 24: 22476-84.
11. Hein DW, Doll MA, Fretland AJ, Leff MA, Webb SJ, Xiao GH. Molecular genetics and epidemiology of the nat1 and nat2 acetylation polymorphisms. Cancer Epidemiol Biomarkers Prev 2000; 9: 29-42.
12. Chelouti H, Khelil M. Arylamine N-acetyltransferase 2 gene polymorphism in an Algerian population. Ann Hum Biol 2017; 44: 531-6.
13. Huang Z, Yuan L, Jiang Z,Wang D. Associations of polymorphisms in NAT2 gene with risk and metastasis of osteosarcoma in young chinese population. OncoTargets Ther 2015; 8: 2675-80.
14. D'souza W, Pradhan S, Saranath D. Multiple single nucleotide polymorphism analysis and association of specific genotypes in FHIT, SAMD4A, and ANKRD17 in Indian patients with oral cancer. Head and Neck 2017; 39: 1586-95.
15. Masood N, Kayani MA, Malik FA, Mahjabeen I, Baig RM, Faryal R. Genetic variation in carcinogen metabolizing genes associated with oral cancer in pakistani population. Asian Pac J Cancer Prev 2011; 12: 491-5.
16. Walraven JM, Zang Y, Trent JO, Hein DW. Structure/function evaluations of single nucleotide polymorphisms in human n-acetyltransferase 2. Curr drug Metabol 2008; 9: 471-86.
17. Hein DW. N-acetyltransferase snps: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine. Expert opin Drug Metabol Toxicol 2009; 5: 353-66.
18. Salazar-González R, Gómez R, Romano-Moreno S, Medellín-Garibay S, Núñez-Ruíz A, Magaña-Aquino M. Expression of NAT2 in immune system cells and the relation of nat2 gene polymorphisms in the anti-tuberculosis therapy in mexican mestizo population. Mol Biol Rep 2014; 41: 7833-43.
19. Singla N, Gupta D, Birbian N, Singh J. Association of NAT2, GST and CYP2E1 polymorphisms and anti-tuberculosis drug-induced hepatotoxicity. Tuberculosis (Edinb) 2014; 94: 293-8.
20. Ribeiro IP, Barroso L, Marques F, Melo JB, Carreira IM. Early detection and personalized treatment in oral cancer: The impact of omics approaches. Mol Cytogenet 2016; 9: 85.
21. Wu HJ, Chi CW, Liu TY. Effects of ph on nicotine-induced DNA damage and oxidative stress. J Toxicol Environ Health A 2005; 68: 1511-23.
22. Jensen C, Hu J, Case L, Browne J, Gilbert J, Metzner-Sidurski J. Stress and depression in head and neck cancer patients by primary surgery versus primary radiotherapy treatment modality. J Clin Oncol 2010; 28: 5597.
23. Manoharan S, Karthikeyan S, Essa M, Manimaran A, Selvasundram R. An overview of oral carcinogenesis. Int J Nutr Pharmacol Neurol Dis 2016; 6: 51-62.
24. How should I reference MedCalc in an article I am writing? [Online] [Cited 2021 Feb 14]. Available from: URL: https://www.medcalc.org/faq/027.php.
25. Medrano RFV, de Oliveira CA. Guidelines for the tetra-primer arms–pcr technique development. Mol Biotechnol 2014; 56: 599-608.
26. Wigginton JE, Cutler DJ, Abecasis GR. A note on exact tests of hardy-weinberg equilibrium. Am J Hum Genet 2005;76: 887-93.
27. Na HS, Lee JS, Cheong HS, Shin HJ, Kang TS, Park HJ, et al. Expression efficiency of NAT2 haplotypes in a Korean population. Genes Genet Syst 2017; 91: 277-81.
28. Loktionov A, Moore W, Spencer SP, Vorster H, Nell T, O'Neill IK, et al. Differences in N-acetylation genotypes between Caucasians and Black South Africans: implications for cancer prevention. Cancer Detect Prev 2002; 26: 15–22.
29. Turesky RJ. Formation and biochemistry of carcinogenic heterocyclic aromatic amines in cooked meats. Toxicol Lett 2007; 168: 219–27.
30. Olshan AF, Weissler MC, Watson MA, Bell DA. GSTM1, GSTT1, GSTP1, CYP1A1, and NAT1 polymorphisms, tobacco use, and the risk of head and neck cancer. Cancer Epidemiology, Biomarkers & Prevention 2000; 9: 185-91.
31. Arslan S, Degerli N, Bardakci F. Distribution of N-acetyltransferase Type 1 (NAT1) genotypes and alleles in a Turkish Population. Genet Mol Biol 2004; 27: 162–4.
32. Wideroff L, Vaughan TL, Farin FM, Gammon MD, Risch H, Stanford JL, et al. GST, NAT1, CYP1A1 polymorphisms and risk of esophageal and gastric adenocarcinomas. Cancer Detect Prev 2007; 31: 233–6.
Related Articles
Journal of the Pakistan Medical Association has agreed to receive and publish manuscripts in accordance with the principles of the following committees:




