Amna Mahmood  ( Department of Biochemistry, Islamic International Medical College, Riphah University, Rawalpindi, Pakistan. )
Amena Rahim  ( Department of Biochemistry, Islamic International Medical College, Rawalpindi. )
Muhammad Afzal  ( Islamic International Medical College, Rawalpindi, Pakistan )
Muhammad Imran Bajwa  ( Department of Biochemistry, Islamic International Medical College, Riphah University, Rawalpindi, Pakistan. )
Yawar Zaman  ( Punjab Employees Social Security Hospital, Islamabad, Pakistan. )
Hira Waqas Cheema  ( Department of Anatomy, Islamic International Medical College, Riphah University, Rawalpindi, Pakistan. )

Objective: To find the association between interleukin-1 receptor-associated kinase 1 rs3027898 gene polymorphism and preeclampsia.

Methods: The case-control study was conducted from October, 2018 to September, 2019 at the Railway General Hospital and the Department of Biochemistry, Islamic International Medical College, Rawalpindi, Pakistan, and comprised patients diagnosed with preeclampsia and healthy controls. The interleukin receptor-associated kinase-1 polymorphism was determined using multiplex tetra primer amplification refractory mutation system polymerase chain reaction. Outcomes were determined in terms of association of interleukin receptor-associated kinase-1 with preeclampsia. Data was analysed using SPSS 22.

Results: Of the 160 subjects, 80(50% were cases with a mean age of 30±5.3 years and 80(50%) were controls with a mean age of 27±3.7 years. AC genotype was seen in 45(56.25%) cases and 30(37.5%)  controls, AA genotype in 25(31.25%) cases and 30(37.5%) controls, while CC genotype was seen in 10(12.5%) cases and 20(25%) controls (p>0.05).

Conclusion: There was no significant association of interleukin receptor-associated kinase-1 genotypes with preeclampsia.

Keywords: Preeclampsia, Interleukin receptor-associated kinase-1, Gene polymorphisms. (JPMA 71: 1332; 2021)

DOI: https://doi.org/10.47391/JPMA.1307

 

Introduction

 

Preeclampsia (PE) is defined as hypertension (HTN) with proteinuria diagnosed after 20 weeks of gestation till 2 weeks postpartum (PP). If  proteinuria is absent, it is diagnosed through HTN with  any of the following: platelet count 100,000/ml, serum creatinine 1.1mg/dl, or doubling of concentration of serum creatinine in the absence of other renal disease, increase in liver  transaminases to twice the normal concentration, pulmonary,  cerebral and visual symptoms.¹ It affects 2-8% of all pregnancies and remains a leading cause of maternal and perinatal deaths worldwide, with around  344,000  women  dying  from PE in the last 10 years.² Approximately 13-26%  small-for-gestational-age infants and 16-21% of all preterm births are due to PE, and the other associated complications of prematurity are  neonatal deaths as well as serious long-term neonatal morbidity.³ PE incidence in pregnant women in Pakistan is 1.2%. The World Health Organisation (WHO) estimates that PE is responsible for 12% maternal mortality in Asia. Ethnicity can be a risk factor for developing PE. The prevalence of PE is different in every country; 3.5% in the United States (US), 9% Brazil, 3% Australia, 12.5% Bangladesh, 3% India, and 5% in Thailand.⁴

The mechanisms involved in development of disease are not clearly understood. The development of preeclampsia is related to placenta, it disappears soon after delivery.⁵

The improper invasion of trophoblast early in pregnancy is the start of the pathological process of PE, causing an increase in oxidative stress (OS), which, in turn, leads to endothelial dysfunction in the second stage of the disease. In case of normal development of placenta, cytotrophoblast cells form extravillous trophoblast which penetrates the decidua and the first three parts of the myometrium. This causes remodelling of spiral vessels into low-resistance vessels which causes increase in blood flow. It is essential for foetus growth.⁶ If the placenta develops abnormally, leading to impaired invasion of trophoblast, there is decrease in uteroplacental blood flow. It is the start of PE.⁷ The state of low blood perfusion is the cause of hypoxia in placenta, local OS, endothelial dysfunction and systemic inflammatory response. The first stage of improper invasion of trophoblast is difficult to diagnose, while high resistance in circulation is a clinical syndrome.⁸

The known risk factors are very young or advanced age of  the mother, low socioeconomic status (SES), smoking, obesity, family history of  PE, history of PE in previous pregnancy, parity and type of pregnancy whether single or multiple, family history of diabetes mellitus (DM) and HTN.⁹

The definite cause of PE is not known, but it is obvious that genes play a definite role. Disorders with  genetic elements  interfere with mother's vascular responses, affect trophoblastic function, or increase the placental mass, causing  foetal  demands to increase in relation to  supply.¹⁰ The genes involved will not cause PE straightaway, but will lower a mother's threshold at which she will develop the disease. Since the diagnostic criterion of PE is based on the continuous distribution of blood pressure (BP) and proteinuria, it is likely that no single aetiology or genetic marker will account for all PE cases. There has been evidence of paternal and foetal genetic effects. The observation that PE is common in molar pregnancies in which all the foetal chromosomes are derived from the father is  evidence for the role of paternal genes.¹⁰ PE is a common but often serious disease for mother or child or both, and a large percentage of modern cases are due to new mutations without a direct familial pattern.¹¹

A study on the genetic association of PE evaluated 350 preeclamptic mother-offspring pairs and 600 control pairs, showing 775 single nucleotide polymorphisms (SNPs) in 190 genes. It detected six genes with significant maternal-foetal genotype interaction related to insulin growth factor-1 (IGF1), interleukin 4 receptor (IL4R), insulin growth factor 2 receptor (IGF2R), gene protein subunit beta 3 (GNB3), colony stimulating factor-1 (CSF1) and thrombospondin 4 (THBS4).

A 2006 study reported that seven genes cover 70% of literature regarding PE genetics.¹² These genes were angiotensinogen (AGT), angiotensin receptors 1 and 2 (AGTR1, AGTR2), coagulation factor V (FV), methylenetetrahydrofolate reductase (MTHFR), nitric oxide synthase 3 (NOS3) and tumour necrosis factor-alpha (TNF-a). The interest in these genes can be explained by their involvement in the underlying aetiologies in the pathogenesis of PE.¹²

IL1-receptor-associated kinase 1  (IRAK-1) is a serine and threonine protein kinase involved in the signalling mechanisms of the toll and IL1 receptor (TIR) family.¹³ On toll-like receptor (TLR) stimulation, IRAK-1 is recruited and phosphorylated into the TLR signalling complex. IRAK-1 is an important intracellular signalling protein that is activated by ligands of TLRs and recognises many  different varieties of ligands, including pathogens, and is involved in pathogen-mediated  inflammation.¹⁴

The current study was planned to assess the association of IRAK-1 rs3027898 gene polymorphism and preeclampsia in the local population.

 

Materials and Methods

 

The case-control study was conducted from October, 2018 to September, 2019 at the Railway General Hospital (RGH) and the Department of Biochemistry, Islamic International Medical College (IIMC), Rawalpindi, Pakistan. After approval from the IIMC ethics review committee, the sample size was calculated using the formula: z2(pq)/e2, where,  z =1.96 deviant error for 0.05, p = prevalence, q = 1- p, and e = tolerance error5. The sample was raised using non-probability convenience sampling technique from among women at the RGH Department of Gynaecology and Obstetrics.

Those included were pregnant females regardless of age and parity who were diagnosed with PE. Also included were age-matched controls who were pregnant with no diagnosis or personal and familial history of PE.

Those excluded were non-pregnant females as well pregnant females diagnosed with HTN, gestational DM or with known autoimmune disorders.

After obtaining informed written consent from the subjects, demographic data was recorded, followed by 4ml blood samples collected by venipuncture after proper antiseptic measures. The samples were labelled with proper name and number, and were transported to lab in K3 ethylenediaminetetraacetic acid (EDTA)-containing vacutainers and were preserved at -80O Celsius until further analysis.

Genomic deoxyribonucleic acid (DNA) was extracted using chelex method from the whole blood and stored at -80O Celsius. IRAK1 polymorphism was determined by tetra-primer amplification refractory mutation system (ARMS) polymerase chain reaction (PCR). Two external primers  forward outer 5'CCATGCCTGGCTAATTTTTGTACTTTTT-3 and reverse outer 5'GTCTTCAGAAGCAAGTCAGGTTTCA TGT-3' and two internal primers, forward inner 5'AGACCCTGGACGCTCAAGAATCA-3 and reverse inner 5'TGAGCTTTCCTGATGCCTTAC ACTTTAG-3, were used.¹⁵ The product sizes were 203bp for the A allele, 157bp for the C allele and 314bp for the control band. PCR reaction ingredients were 25ml of DreamTaq Green master mix (2x) (Thermoscientific) which consists of 1. DreamTaq DNA polymerase, 2.2x DreamTaq Green buffer, 3.4mM magnesium chloride (MgCl2), 4.0.4Mm each of deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), 14.5ml distilled water, 2ml of each inner forward and reverse primer (10uM) and 2ml of each outer forward and reverse primer (12uM) (M/s Macrogen), 1.5ml of DNA, and 14.5mL distilled water. PCR (Major Science Thermocycler) cycling conditions were initial denturation at 95°C for 5min, followed by loop 1 of 20 cycles: 30sec of denaturation at 95°C, 30sec of annealing at 66°C and 30 sec of extension at 72°C. It was followed by loop 2 of 20 cycles: 30sec of denaturation at 95°C, 30sec of annealing at 64°C, and 30sec of extension at 72°C. Final common extension step was at 72°C for 10min. PCR products were visualised on 2% agarose gel and estimated in comparison to 100bp DNA ladder. Electrophoresis was done at ~100 volts for 40-50 minutes. Gel documentation was done by placing the gel on ultra-violet (UV) trans-illuminator. The amplified DNA fragments were seen as whitish bands (Figure).

 

 

Data was analyzed using SPSS 22. Chi-square test was used to find significance among different variables in the study groups and genotypes of IRAK1 that were AA, AC and CC. Odds ratio (OR) with 95% confidence interval (CI) was calculated for genotypes of IRAK1 to find their association with cases and controls. P<0.05 was taken as significant.

 

Results

 

Of the 160 subjects, 80(50% were cases with a mean age of 30±5.3 years and 80(50%) were controls with a mean age of 27±3.7 years (p>0.05). Family history of HTN, weight and parity were significantly different between the groups (Table-1).

 

 

AC genotype was seen in 45(56.25%) cases and 30(37.5%) controls, AA genotype in 25(31.25%) cases and 30(37.5%) controls, while CC genotype was seen in 10(12.5%) cases and 20(25%) controls. The difference between the groups was significant (Table-2).

 

 

Genotypic frequency of IRAK1 between the cases and the controls was not significant (Table-3).

 

 

Discussion

 

Genetic association of IRAK1 have been studied in many autoimmune disorders, like rheumatoid arthritis (RA),¹⁶ cerebral infarction,¹⁷ systemic lupus erythematosus (SLE),¹⁸ psoriatic arthritis,¹⁹ Sjogern syndrome (SS)²⁰ and septic shock.²¹

The current study showed significant association of maternal age of cases with genotypes of IRAK1. Studies have concluded that PE risk increases with increasing maternal age.²² The current study showed significant association of family history of HTN of cases with IRAK1 genotypes. This finding is in agreement with studies conducted in Brazil,²³ Sudan²⁴ and Uganda.^23,25 This is due to genetic factors that contribute to the physiological predisposition of PE. Maternal risk factors, like family history of HTN, badly affect the capability of the placenta to cater with decreased placental perfusion, resulting in a reduction in the supply of nutrients to the foetus.²⁶ The current study showed significant association of weight of the cases with IRAK1genotypes. It is a well established fact that increased maternal weight is related to increased pregnancy complications, like PE. A study showed that  obesity before pregnancy gives a 30% risk for PE in pregnant women with body mass index (BMI) >35.²⁷ Also, there was a significant association between IRAK1 genotypes with parity. Some studies have not shown significant association between parity and PE.²⁸

The current study is first in Pakistan to explore the association of genetic polymorphism of IRAK1 with PE.

Polymorphisms of rs3027898 and rs1059702 of IRAK1 gene were associated with SLE in Chinese Han population; the C allele of rs3027898 was associated with a decreased risk for patients with oral ulcers.²⁹

The IRAK1 gene is recognised as a risk gene in autoimmune disorders. Three SNPs  in IRAK1, namely, rs3027898, rs1059702 and rs1059703, are considered to be associated with risk of autoimmune disorders.³⁰

Polymorphisms of IRAK1 gene rs3027898 and rs1059703 did not have any association with juvenile autoimmune arthritis in India.¹⁹

In China, IRAK1  gene was found to be a crucial risk factor for autoimmune thyroid diseases.³¹

 

Conclusion

 

There was no significant association of IRAK1 genotypes with preeclampsia among the studied subjects.

 

Disclaimer: None.

Conflict of Interest: None.

Source of Funding: None.

 

References

 

1.      Phipps E, Prasanna D, Brima W, Jim B. Preeclampsia: Updates in Pathogenesis, Definitions, and Guidelines. Clin J Am Soc Nephrol 2016;11:1102-13. doi: 10.2215/CJN.12081115.

2.      Hansen AT, Bernth Jensen JM, Hvas AM, Christiansen M. The genetic component of preeclampsia: A whole-exome sequencing study. PLoS One 2018;13:e0197217. doi: 10.1371/journal.pone.0197217.

3.      Jeyabalan A. Epidemiology of preeclampsia: impact of obesity. Nutr Rev 2013;71(Suppl 1):s18-25. doi: 10.1111/nure.12055.

4.      Kharaghani R, Cheraghi Z, Okhovat Esfahani B, Mohammadian Z, Nooreldinc RS. Prevalence of Preeclampsia and Eclampsia in Iran. Arch Iran Med 2016;19:64-71.

5.      Parvatikar S. A comparative study of serum uric acid,  c-reactive protein and serum calcium in preeclampsia and normal pregnancy. [Online] 2013 [Cited 2021 February 25]. Available from URL: http://52.172.27.147:8080/jspui/bitstream/123456789/8464/1/Shruti%20Parvatikar.pdf

6.      Whitley GS, Cartwright JE. Cellular and molecular regulation of spiral artery remodelling: lessons from the cardiovascular field. Placenta 2010;31:465-74. doi: 10.1016/j.placenta.2010.03.002.

7.      Burton GJ, Yung HW, Cindrova-Davies T, Charnock-Jones DS. Placental endoplasmic reticulum stress and oxidative stress in the pathophysiology of unexplained intrauterine growth restriction and early onset preeclampsia. Placenta 2009;30(Suppl A):s43-8. doi: 10.1016/j.placenta.2008.11.003.

8.      Valenzuela FJ, Pérez-Sepúlveda A, Torres MJ, Correa P, Repetto GM, Illanes SE. Pathogenesis of preeclampsia: the genetic component. J Pregnancy 2012;2012:e632732. doi: 10.1155/2012/632732.

9.      Duckitt K, Harrington D. Risk factors for pre-eclampsia at antenatal booking: systematic review of controlled studies. BMJ 2005;330:565. doi: 10.1136/bmj.38380.674340.E0.

10.    Ward K, Taylor RN. Genetic factors in the etiology of preeclampsia/eclampsia. In: Taylor RN, Roberts JM, Cunningham FG, Lindheimer MD, eds. Chesley's hypertensive disorders in pregnancy, 4th ed. San Diego, California: Elsevier Inc, 2015; pp 57-80.

11.    Cnattingius S, Reilly M, Pawitan Y, Lichtenstein P. Maternal and fetal genetic factors account for most of familial aggregation of preeclampsia: a population-based Swedish cohort study. Am J Med Genet A 2004;130:365-71. doi: 10.1002/ajmg.a.30257.

12.    Silva VR, Soardi FC, Tanaka SC, da Silva-Grecco RL, Paschoini MC, Balarin MA. Investigation of polymorphisms in pre-eclampsia related genes VEGF and IL1A. Arch Gynecol Obstet 2015;291:1029-35. doi: 10.1007/s00404-014-3503-2.

13.    Huang Y, Li T, Sane DC, Li L. IRAK1 serves as a novel regulator essential for lipopolysaccharide-induced interleukin-10 gene expression. J Biol Chem 2004;279:51697-703. doi: 10.1074/jbc.M410369200.

14.    Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000;406:782-7. doi: 10.1038/35021228.

15.    Atabaki M, Hashemi M, Daneshvar H, Alijani E. Association between interleukin-1 receptor associated kinase 1 rs3027898 A/C gene polymorphism and rheumatoid arthritis. Biomed Rep 2017;6:335-8. doi: 10.3892/br.2017.855.

16.    Yang XK, Li P, Zhang C, Leng RX, Li S, Liu J, et al. Association between IRAK1 rs3027898 and miRNA-499 rs3746444 polymorphisms and rheumatoid arthritis: A case control study and meta-analysis. Z Rheumatol 2017;76:622-9. doi: 10.1007/s00393-016-0169-0.

17.    Chu B, Zhou Y, Zhai H, Li L, Sun L, Li Y. The role of microRNA-146a in regulating the expression of IRAK1 in cerebral ischemia-reperfusion injury. Can J Physiol Pharmacol 2018;96:611-7. doi: 10.1139/cjpp-2017-0586.

18.    Dai C, Deng Y, Quinlan A, Gaskin F, Tsao BP, Fu SM. Genetics of systemic lupus erythematosus: immune responses and end organ resistance to damage. Curr Opin Immunol 2014;31:87-96. doi: 10.1016/j.coi.2014.10.004.

19.    Singh S, Rai G, Aggarwal A. Association of microRNA-146a and its target gene IRAK1 polymorphism with enthesitis related arthritis category of juvenile idiopathic arthritis. Rheumatol Int 2014;34:1395-400. doi: 10.1007/s00296-014-3001-7.

20.    Shi H, Zheng LY, Zhang P, Yu CQ. miR-146a and miR-155 expression in PBMCs from patients with Sjögren's syndrome. J Oral Pathol Med 2014;43:792-7. doi: 10.1111/jop.12187.

21.    Gao M, Wang X, Zhang X, Ha T, Ma H, Liu L, et al. Attenuation of Cardiac Dysfunction in Polymicrobial Sepsis by MicroRNA-146a Is Mediated via Targeting of IRAK1 and TRAF6 Expression. J Immunol 2015;195:672-82. doi: 10.4049/jimmunol.1403155.

22.    Paré E, Parry S, McElrath TF, Pucci D, Newton A, Lim KH. Clinical risk factors for preeclampsia in the 21st century. Obstet Gynecol 2014;124:763-70. doi: 10.1097/AOG.0000000000000451.

23.    Lobato G, Nakamura-Pereira M, Mendes-Silva W, Dias MA, Reichenheim ME. Comparing different diagnostic approaches to severe maternal morbidity and near-miss: a pilot study in a Brazilian tertiary hospital. Eur J Obstet Gynecol Reprod Biol 2013;167:24-8. doi: 10.1016/j.ejogrb.2012.10.030.

24.    Bilano VL, Ota E, Ganchimeg T, Mori R, Souza JP. Risk factors of pre-eclampsia/eclampsia and its adverse outcomes in low- and middle-income countries: a WHO secondary analysis. PLoS One 2014;9:e91198. doi: 10.1371/journal.pone.0091198.

25.    Nakimuli A, Nakubulwa S, Kakaire O, Osinde MO, Mbalinda SN, Kakande N, et al. The burden of maternal morbidity and mortality attributable to hypertensive disorders in pregnancy: a prospective cohort study from Uganda. BMC Pregnancy Childbirth 2016;16:205. doi: 10.1186/s12884-016-1001-1.

26.    Ye C, Ruan Y, Zou L, Li G, Li C, Chen Y, et al. The 2011 survey on hypertensive disorders of pregnancy (HDP) in China: prevalence, risk factors, complications, pregnancy and perinatal outcomes. PLoS One 2014;9:e100180. doi: 10.1371/journal.pone.0100180.

27.    Spradley FT, Palei AC, Granger JP. Increased risk for the development of preeclampsia in obese pregnancies: weighing in on the mechanisms. Am J Physiol Regul Integr Comp Physiol 2015;309:1326-43. doi: 10.1152/ajpregu.00178.2015.

28.    Košir Pogačnik R, Trojner Bregar A, Lučovnik M, Krajec M, Verdenik I, Blickstein I, et al. The effect of interaction between parity, gestational diabetes, and pregravid obesity on the incidence of preeclampsia. J Matern Fetal Neonatal Med 2020;33:931-4. doi: 10.1080/14767058.2018.1509311.

29.    Zhai Y, Xu K, Leng RX, Cen H, Wang W, Zhu Y, et al. Association of interleukin-1 receptor-associated kinase (IRAK1) gene polymorphisms (rs3027898, rs1059702) with systemic lupus erythematosus in a Chinese Han population. Inflamm Res 2013;62:555-60. doi: 10.1007/s00011-013-0607-2.

30.    Li C, Huang S, Mo S, Zhang N, Zhou L, Mao Z, et al. Susceptibility of autoimmune diseases in three polymorphisms of infectionassociated gene IRAK1. J Infect Dev Ctries 2015;9:614-23. doi: 10.3855/jidc.6776.

31.    Song RH, Qin Q, Yan N, Muhali FS, Meng S, He ST, et al. Variants in IRAK1-MECP2 region confer susceptibility to autoimmune thyroid diseases. Mol Cell Endocrinol 2015;399:244-9. doi: 10.1016/j.mce.2014.10.013.